This tutorial was created by Angela Oliverio and Hannah
Holland-Moritz, and is maintained by Cliff Bueno de Mesquita and other
current members of the Fierer Lab
Updated November 16th, 2024
This pipeline runs the dada2 workflow for Big Data (paired-end) from RStudio on the microbe server.
We suggest opening the dada2 tutorial online to understand more about each step. The original pipeline on which this tutorial is based can be found here: https://benjjneb.github.io/dada2/bigdata_paired.html
| NOTE: There is a slightly different pipeline for ITS and non-“Big data” workflows. The non-“Big data” pipeline, in particular, has very nice detailed explanations for each step and can be found here: https://benjjneb.github.io/dada2/tutorial.html |
Check to make sure you know what your target ‘AMPLICON’ length is. This can vary between primer sets, as well as WITHIN primer sets. For example, ITS (internal transcribed spacer) amplicons can vary from ~100 bps to 300 bps.
For examples regarding commonly used primer sets (515f/806r, Fungal ITS2, 1391f/EukBr) see protocols on the Earth Microbiome Project website: http://press.igsb.anl.gov/earthmicrobiome/protocols-and-standards/
Check to make sure you know how long your reads should be (i.e., how long should the reads be coming off the sequencer?) This is not the same as fragment length, as many times, especially with longer fragments, the entire fragment is not being sequenced in one direction. When long amplicons are not sequenced with a read length that allows for substantial overlap between the forward and reverse read, you can potentially insert biases into the data. If you intend to merge your paired end reads, ensure that your read length is appropriate. For example, with a MiSeq 2 x 150, 300 cycle kit, you will get bidirectional reads of 150 base pairs.
Make note of which sequencing platform was used, as this can impact both read quality and downstream analysis.
Decide which database is best suited for your analysis needs. Note that DADA2 requires databases be in a custom format! If a custom database is required, further formatting will be needed to ensure that it can run correctly in dada2.
See the following link for details regarding database formatting: https://benjjneb.github.io/dada2/training.html#formatting-custom-databases
For additional tutorials and reporting issues, please see link
below:
dada2 tutorial: https://benjjneb.github.io/dada2/tutorial.html
dada2 pipeline issues*: https://github.com/fiererlab/dada2_fiererlab/issues
*Note by default, only ‘OPEN’ issues are shown. You can look at all issues by removing “is:open” in the search bar at the top.
If you are running it through Fierer Lab “microbe” server:
To use the microbe server, open a terminal window, and type and hit return:
ssh <your microbe user name>@microbe.colorado.edu
Setting up your password:
When you log in for the first time, you will have to set a new password. First, log in using your temporary password. The command prompt will then ask you to write a new password. Type it in once and hit return, then type it in again to verify. When you set a new password, make sure that it is something secure (i.e. has at least letters and numbers in it). Note, nothing will show up on the screen when you enter passwords.
Important: DO NOT give out your password to anyone!
Once you have logged in, you can download a copy of the tutorial into your directory on the server. To retrieve the folder with this tutorial from github directly to the server, type the following into your terminal and hit return after each line.
wget https://github.com/fiererlab/dada2_fiererlab/archive/master.zip
unzip master.zip
If there are ever updates to the tutorial on github, you can update the contents of this folder by downloading the new version from the same link as above.
microbe.colorado.edu:8787 in the address barIf you are running it on your own computer (runs slower!):
First open the R script in Rstudio. The R script is located in the tutorial folder you downloaded in the first step. You can navigate to the proper folder in Rstudio by clicking on the files tab and navigating to the location where you downloaded the github folder. Then click dada2_fiererlab and dada2_tutorial_16S.R to open the R script.
Now, install DADA2 & other necessary packages. If this is your first time on Rstudio server, when you install a package you might get a prompt asking if you want to create your own library. Answer ‘yes’ twice in the console to continue.
| WARNING: This installation may take a long time, so only run this code if these packages are not already installed! |
install.packages("BiocManager")
BiocManager::install("dada2")
BiocManager::install("ShortRead")
install.packages("dplyr")
install.packages("tidyr")
install.packages("Hmisc")
install.packages("ggplot2")
install.packages("plotly")
Load DADA2 and required packages
library(dada2); packageVersion("dada2") # the dada2 pipeline
## [1] '1.32.0'
library(ShortRead); packageVersion("ShortRead") # dada2 depends on this
## [1] '1.62.0'
library(dplyr); packageVersion("dplyr") # for manipulating data
## [1] '1.1.4'
library(tidyr); packageVersion("tidyr") # for creating the final graph at the end of the pipeline
## [1] '1.3.1'
library(Hmisc); packageVersion("Hmisc") # for creating the final graph at the end of the pipeline
## [1] '5.1.3'
library(ggplot2); packageVersion("ggplot2") # for creating the final graph at the end of the pipeline
## [1] '3.5.1'
library(plotly); packageVersion("plotly") # enables creation of interactive graphs, especially helpful for quality plots
## [1] '4.10.4'
Once the packages are installed, you can check to make sure the auxiliary software is working and set up some of the variables that you will need along the way.
| NOTE: If you are not working from microbe server, you will need to change the file paths for idemp and cutadapt to where they are stored on your computer/server. |
For this tutorial we will be working with some samples that we obtained 16S amplicon data for, from a Illumina Miseq run. The data for these samples can be found on the CME website. http://cme.colorado.edu/projects/bioinformatics-tutorials
# Set up pathway to idemp (demultiplexing tool) and test
idemp <- "/usr/bin/idemp" # CHANGE ME if not on microbe
system2(idemp) # Check that idemp is in your path and you can run shell commands from R
# Set up pathway to cutadapt (primer trimming tool) and test
cutadapt <- "/usr/local/Python27/bin/cutadapt" # CHANGE ME if not on microbe
system2(cutadapt, args = "--version") # Check by running shell command from R
# Set path to shared data folder and contents
data.fp <- "/data/shared/2019_02_20_MicrMethods_tutorial"
# List all files in shared folder to check path
list.files(data.fp)
## [1] "barcode_demultiplex_short.txt"
## [2] "CompletedJobInfo.xml"
## [3] "cvanderburgh"
## [4] "GenerateFASTQRunStatistics.xml"
## [5] "Molecular_Methods_18_515fBC_16S_Mapping_File_SHORT_vFinal_Fierer_10252018.txt"
## [6] "other_files"
## [7] "RunInfo.xml"
## [8] "runParameters.xml"
## [9] "Undetermined_S0_L001_I1_001.fastq.gz"
## [10] "Undetermined_S0_L001_R1_001.fastq.gz"
## [11] "Undetermined_S0_L001_R2_001.fastq.gz"
# Set file paths for barcodes file, map file, and fastqs
# Barcodes may need to have 'N' on the end of each 12bp sequence for compatibility
# Barcode file must have column 1 with barcodes and column 2 with sample IDs
barcode.fp <- file.path(data.fp, "barcode_demultiplex_short.txt") # .txt file: barcode </t> sampleID
I1.fp <- file.path(data.fp, "Undetermined_S0_L001_I1_001.fastq.gz")
R1.fp <- file.path(data.fp, "Undetermined_S0_L001_R1_001.fastq.gz")
R2.fp <- file.path(data.fp, "Undetermined_S0_L001_R2_001.fastq.gz")
| NOTE: idemp relies on having a match in length between the index file and and the barcode sequences. Since the index file usually includes a extra linker basepair (making it 13bp long), you should append the barcode sequences with “N” to make sure each is 13bp long. If you are not sure of the length of index reads, check with the sequencing center. If your index reads are 12bp long, you do NOT need to add an “N”. |
For ITS, 18S, and Univeral Barcode Primers: Depending on how your sequences were run and how your primers were designed your barcodes may need to be reverse-complemented. A good clue that you might need to reverse complement your barcodes is if your first attempt at demultiplexing results in the wrong number of demultiplexed files, or if your demultiplexed files are really small. Here is a link to a handy tool, that can help you reverse complement your barcodes: http://arep.med.harvard.edu/labgc/adnan/projects/Utilities/revcomp.html
Set up file paths in YOUR directory where you want data; you do not need to create the subdirectories but they are nice to have for organizational purposes.
project.fp <- "/data/cliffb/MicroMethods_dada2_tutorial" # CHANGE ME to project directory; don't append with a "/"
# Set up names of sub directories to stay organized
preprocess.fp <- file.path(project.fp, "01_preprocess")
demultiplex.fp <- file.path(preprocess.fp, "demultiplexed")
filtN.fp <- file.path(preprocess.fp, "filtN")
trimmed.fp <- file.path(preprocess.fp, "trimmed")
filter.fp <- file.path(project.fp, "02_filter")
table.fp <- file.path(project.fp, "03_tabletax")
Demultiplexing splits your reads out into separate files based on the barcodes associated with each sample. If you already have demultiplexed files, you can skip this step. Just put the demultiplexed fastq files in your demultiplex file path “demultiplex.fp”, and make sure the forward read file names start with R1_ and the reverse read file names start with R2_.
flags <- paste("-b", barcode.fp, "-I1", I1.fp, "-R1", R1.fp, "-R2", R2.fp, "-o", demultiplex.fp)
system2(idemp, args = flags)
# Look at output of demultiplexing
list.files(demultiplex.fp)
## [1] "R1_ANT7.fastq.gz"
## [2] "R1_ANT8.fastq.gz"
## [3] "R1_BA1A5566_10_1D.fastq.gz"
## [4] "R1_BA1A5566_22_1C.fastq.gz"
## [5] "R1_BA1A5566_45_1J.fastq.gz"
## [6] "R1_BB1S.fastq.gz"
## [7] "R1_BB1W.fastq.gz"
## [8] "R1_BNS1.fastq.gz"
## [9] "R1_BNS2.fastq.gz"
## [10] "R1_C2S.fastq.gz"
## [11] "R1_C2W.fastq.gz"
## [12] "R1_CM2A_10_9C.fastq.gz"
## [13] "R1_CM2A_22_9J.fastq.gz"
## [14] "R1_COL11.fastq.gz"
## [15] "R1_COL12.fastq.gz"
## [16] "R1_COL3.fastq.gz"
## [17] "R1_COL4.fastq.gz"
## [18] "R1_DT3S.fastq.gz"
## [19] "R1_DT3W.fastq.gz"
## [20] "R1_OM18_BC.fastq.gz"
## [21] "R1_OM18_BJ.fastq.gz"
## [22] "R1_WAB105_22_6J.fastq.gz"
## [23] "R1_WAB105_45_6D.fastq.gz"
## [24] "R1_WAB188_10_4D.fastq.gz"
## [25] "R1_WAB71_45_3D.fastq.gz"
## [26] "R2_ANT7.fastq.gz"
## [27] "R2_ANT8.fastq.gz"
## [28] "R2_BA1A5566_10_1D.fastq.gz"
## [29] "R2_BA1A5566_22_1C.fastq.gz"
## [30] "R2_BA1A5566_45_1J.fastq.gz"
## [31] "R2_BB1S.fastq.gz"
## [32] "R2_BB1W.fastq.gz"
## [33] "R2_BNS1.fastq.gz"
## [34] "R2_BNS2.fastq.gz"
## [35] "R2_C2S.fastq.gz"
## [36] "R2_C2W.fastq.gz"
## [37] "R2_CM2A_10_9C.fastq.gz"
## [38] "R2_CM2A_22_9J.fastq.gz"
## [39] "R2_COL11.fastq.gz"
## [40] "R2_COL12.fastq.gz"
## [41] "R2_COL3.fastq.gz"
## [42] "R2_COL4.fastq.gz"
## [43] "R2_DT3S.fastq.gz"
## [44] "R2_DT3W.fastq.gz"
## [45] "R2_OM18_BC.fastq.gz"
## [46] "R2_OM18_BJ.fastq.gz"
## [47] "R2_WAB105_22_6J.fastq.gz"
## [48] "R2_WAB105_45_6D.fastq.gz"
## [49] "R2_WAB188_10_4D.fastq.gz"
## [50] "R2_WAB71_45_3D.fastq.gz"
## [51] "Unassigned_reads1.fastq.gz"
## [52] "Unassigned_reads2.fastq.gz"
## [53] "Undetermined_S0_L001_I1_001.fastq.gz.decode"
## [54] "Undetermined_S0_L001_I1_001.fastq.gz.decode.stat"
## [55] "Undetermined_S0_L001_R1_001.fastq.gz_ANT7.fastq.gz"
## [56] "Undetermined_S0_L001_R1_001.fastq.gz_ANT8.fastq.gz"
## [57] "Undetermined_S0_L001_R1_001.fastq.gz_BA1A5566_10_1D.fastq.gz"
## [58] "Undetermined_S0_L001_R1_001.fastq.gz_BA1A5566_22_1C.fastq.gz"
## [59] "Undetermined_S0_L001_R1_001.fastq.gz_BA1A5566_45_1J.fastq.gz"
## [60] "Undetermined_S0_L001_R1_001.fastq.gz_BB1S.fastq.gz"
## [61] "Undetermined_S0_L001_R1_001.fastq.gz_BB1W.fastq.gz"
## [62] "Undetermined_S0_L001_R1_001.fastq.gz_BNS1.fastq.gz"
## [63] "Undetermined_S0_L001_R1_001.fastq.gz_BNS2.fastq.gz"
## [64] "Undetermined_S0_L001_R1_001.fastq.gz_C2S.fastq.gz"
## [65] "Undetermined_S0_L001_R1_001.fastq.gz_C2W.fastq.gz"
## [66] "Undetermined_S0_L001_R1_001.fastq.gz_CM2A_10_9C.fastq.gz"
## [67] "Undetermined_S0_L001_R1_001.fastq.gz_CM2A_22_9J.fastq.gz"
## [68] "Undetermined_S0_L001_R1_001.fastq.gz_COL11.fastq.gz"
## [69] "Undetermined_S0_L001_R1_001.fastq.gz_COL12.fastq.gz"
## [70] "Undetermined_S0_L001_R1_001.fastq.gz_COL3.fastq.gz"
## [71] "Undetermined_S0_L001_R1_001.fastq.gz_COL4.fastq.gz"
## [72] "Undetermined_S0_L001_R1_001.fastq.gz_DT3S.fastq.gz"
## [73] "Undetermined_S0_L001_R1_001.fastq.gz_DT3W.fastq.gz"
## [74] "Undetermined_S0_L001_R1_001.fastq.gz_OM18_BC.fastq.gz"
## [75] "Undetermined_S0_L001_R1_001.fastq.gz_OM18_BJ.fastq.gz"
## [76] "Undetermined_S0_L001_R1_001.fastq.gz_unsigned.fastq.gz"
## [77] "Undetermined_S0_L001_R1_001.fastq.gz_WAB105_22_6J.fastq.gz"
## [78] "Undetermined_S0_L001_R1_001.fastq.gz_WAB105_45_6D.fastq.gz"
## [79] "Undetermined_S0_L001_R1_001.fastq.gz_WAB188_10_4D.fastq.gz"
## [80] "Undetermined_S0_L001_R1_001.fastq.gz_WAB71_45_3D.fastq.gz"
## [81] "Undetermined_S0_L001_R2_001.fastq.gz_ANT7.fastq.gz"
## [82] "Undetermined_S0_L001_R2_001.fastq.gz_ANT8.fastq.gz"
## [83] "Undetermined_S0_L001_R2_001.fastq.gz_BA1A5566_10_1D.fastq.gz"
## [84] "Undetermined_S0_L001_R2_001.fastq.gz_BA1A5566_22_1C.fastq.gz"
## [85] "Undetermined_S0_L001_R2_001.fastq.gz_BA1A5566_45_1J.fastq.gz"
## [86] "Undetermined_S0_L001_R2_001.fastq.gz_BB1S.fastq.gz"
## [87] "Undetermined_S0_L001_R2_001.fastq.gz_BB1W.fastq.gz"
## [88] "Undetermined_S0_L001_R2_001.fastq.gz_BNS1.fastq.gz"
## [89] "Undetermined_S0_L001_R2_001.fastq.gz_BNS2.fastq.gz"
## [90] "Undetermined_S0_L001_R2_001.fastq.gz_C2S.fastq.gz"
## [91] "Undetermined_S0_L001_R2_001.fastq.gz_C2W.fastq.gz"
## [92] "Undetermined_S0_L001_R2_001.fastq.gz_CM2A_10_9C.fastq.gz"
## [93] "Undetermined_S0_L001_R2_001.fastq.gz_CM2A_22_9J.fastq.gz"
## [94] "Undetermined_S0_L001_R2_001.fastq.gz_COL11.fastq.gz"
## [95] "Undetermined_S0_L001_R2_001.fastq.gz_COL12.fastq.gz"
## [96] "Undetermined_S0_L001_R2_001.fastq.gz_COL3.fastq.gz"
## [97] "Undetermined_S0_L001_R2_001.fastq.gz_COL4.fastq.gz"
## [98] "Undetermined_S0_L001_R2_001.fastq.gz_DT3S.fastq.gz"
## [99] "Undetermined_S0_L001_R2_001.fastq.gz_DT3W.fastq.gz"
## [100] "Undetermined_S0_L001_R2_001.fastq.gz_OM18_BC.fastq.gz"
## [101] "Undetermined_S0_L001_R2_001.fastq.gz_OM18_BJ.fastq.gz"
## [102] "Undetermined_S0_L001_R2_001.fastq.gz_unsigned.fastq.gz"
## [103] "Undetermined_S0_L001_R2_001.fastq.gz_WAB105_22_6J.fastq.gz"
## [104] "Undetermined_S0_L001_R2_001.fastq.gz_WAB105_45_6D.fastq.gz"
## [105] "Undetermined_S0_L001_R2_001.fastq.gz_WAB188_10_4D.fastq.gz"
## [106] "Undetermined_S0_L001_R2_001.fastq.gz_WAB71_45_3D.fastq.gz"
| WARNING: The demultiplexing step may take a while. If it takes too long you can safely close RStudio on the server and the demultiplexing will run in the background. You should be able to resume the pipeline after demultiplexing is complete by logging back into RStudio on the server. |
# Change names of unassignable reads so they are not included in downstream processing
unassigned_1 <- paste0("mv", " ", demultiplex.fp, "/Undetermined_S0_L001_R1_001.fastq.gz_unsigned.fastq.gz",
" ", demultiplex.fp, "/Unassigned_reads1.fastq.gz")
unassigned_2 <- paste0("mv", " ", demultiplex.fp, "/Undetermined_S0_L001_R2_001.fastq.gz_unsigned.fastq.gz",
" ", demultiplex.fp, "/Unassigned_reads2.fastq.gz")
system(unassigned_1)
system(unassigned_2)
# Rename files - use gsub to get names in order!
R1_names <- gsub(paste0(demultiplex.fp, "/Undetermined_S0_L001_R1_001.fastq.gz_"), "",
list.files(demultiplex.fp, pattern="Undetermined_S0_L001_R1_001", full.names = TRUE))
file.rename(list.files(demultiplex.fp, pattern="Undetermined_S0_L001_R1_001", full.names = TRUE),
paste0(demultiplex.fp, "/R1_", R1_names))
## [1] TRUE TRUE TRUE TRUE TRUE TRUE TRUE TRUE TRUE TRUE TRUE TRUE TRUE TRUE TRUE
## [16] TRUE TRUE TRUE TRUE TRUE TRUE TRUE TRUE TRUE TRUE
R2_names <- gsub(paste0(demultiplex.fp, "/Undetermined_S0_L001_R2_001.fastq.gz_"), "",
list.files(demultiplex.fp, pattern="Undetermined_S0_L001_R2_001", full.names = TRUE))
file.rename(list.files(demultiplex.fp, pattern="Undetermined_S0_L001_R2_001", full.names = TRUE),
paste0(demultiplex.fp, "/R2_", R2_names))
## [1] TRUE TRUE TRUE TRUE TRUE TRUE TRUE TRUE TRUE TRUE TRUE TRUE TRUE TRUE TRUE
## [16] TRUE TRUE TRUE TRUE TRUE TRUE TRUE TRUE TRUE TRUE
# Get full paths for all files and save them for downstream analyses
# Forward and reverse fastq filenames have format:
fnFs <- sort(list.files(demultiplex.fp, pattern="R1_", full.names = TRUE))
fnRs <- sort(list.files(demultiplex.fp, pattern="R2_", full.names = TRUE))
Ambiguous bases will make it hard for cutadapt to find short primer sequences in the reads. To solve this problem, we will remove sequences with ambiguous bases (Ns)
# Name the N-filtered files to put them in filtN/ subdirectory
fnFs.filtN <- file.path(preprocess.fp, "filtN", basename(fnFs))
fnRs.filtN <- file.path(preprocess.fp, "filtN", basename(fnRs))
# Filter Ns from reads and put them into the filtN directory
filterAndTrim(fnFs, fnFs.filtN, fnRs, fnRs.filtN, maxN = 0, multithread = TRUE)
# CHANGE multithread to FALSE on Windows (here and elsewhere in the program)
Note: The
multithread = TRUE setting can sometimes generate an error
(names not equal). If this occurs, try rerunning the function. The error
normally does not occur the second time. |
Assign the primers you used to “FWD” and “REV” below. Note primers should be not be reverse complemented ahead of time. Our tutorial data uses 515f and 806br. Those are the primers below. Change if you sequenced with other primers. See the Earth Microbiome project for standard 16S, 18S, and ITS primer sequences.
For ITS data: CTTGGTCATTTAGAGGAAGTAA is
the ITS forward primer sequence (ITS1F) and
GCTGCGTTCTTCATCGATGC is ITS reverse primer sequence
(ITS2)
# Set up the primer sequences to pass along to cutadapt
FWD <- "GTGYCAGCMGCCGCGGTAA" ## CHANGE ME # this is 515f
REV <- "GGACTACNVGGGTWTCTAAT" ## CHANGE ME # this is 806Br
# Write a function that creates a list of all orientations of the primers
allOrients <- function(primer) {
# Create all orientations of the input sequence
require(Biostrings)
dna <- DNAString(primer) # The Biostrings works w/ DNAString objects rather than character vectors
orients <- c(Forward = dna, Complement = complement(dna), Reverse = reverse(dna),
RevComp = reverseComplement(dna))
return(sapply(orients, toString)) # Convert back to character vector
}
# Save the primer orientations to pass to cutadapt
FWD.orients <- allOrients(FWD)
REV.orients <- allOrients(REV)
FWD.orients
## Forward Complement Reverse
## "GTGYCAGCMGCCGCGGTAA" "CACRGTCGKCGGCGCCATT" "AATGGCGCCGMCGACYGTG"
## RevComp
## "TTACCGCGGCKGCTGRCAC"
REV.orients
## Forward Complement Reverse
## "GGACTACNVGGGTWTCTAAT" "CCTGATGNBCCCAWAGATTA" "TAATCTWTGGGVNCATCAGG"
## RevComp
## "ATTAGAWACCCBNGTAGTCC"
# Write a function that counts how many time primers appear in a sequence
primerHits <- function(primer, fn) {
# Counts number of reads in which the primer is found
nhits <- vcountPattern(primer, sread(readFastq(fn)), fixed = FALSE)
return(sum(nhits > 0))
}
Before running cutadapt, we will look at primer detection for the first couple samples, as a check. There may be some primers here, we will remove them below using cutadapt. If your first couple samples happen to be blanks, change the number to a real sample.
rbind(FWD.ForwardReads = sapply(FWD.orients, primerHits, fn = fnFs.filtN[[1]]),
FWD.ReverseReads = sapply(FWD.orients, primerHits, fn = fnRs.filtN[[1]]),
REV.ForwardReads = sapply(REV.orients, primerHits, fn = fnFs.filtN[[1]]),
REV.ReverseReads = sapply(REV.orients, primerHits, fn = fnRs.filtN[[1]]))
## Forward Complement Reverse RevComp
## FWD.ForwardReads 2 0 0 0
## FWD.ReverseReads 0 0 0 35
## REV.ForwardReads 0 0 0 56
## REV.ReverseReads 0 0 0 0
rbind(FWD.ForwardReads = sapply(FWD.orients, primerHits, fn = fnFs.filtN[[2]]),
FWD.ReverseReads = sapply(FWD.orients, primerHits, fn = fnRs.filtN[[2]]),
REV.ForwardReads = sapply(REV.orients, primerHits, fn = fnFs.filtN[[2]]),
REV.ReverseReads = sapply(REV.orients, primerHits, fn = fnRs.filtN[[2]]))
## Forward Complement Reverse RevComp
## FWD.ForwardReads 0 0 0 0
## FWD.ReverseReads 0 0 0 39
## REV.ForwardReads 0 0 0 62
## REV.ReverseReads 0 0 0 0
# Create directory to hold the output from cutadapt
if (!dir.exists(trimmed.fp)) dir.create(trimmed.fp)
fnFs.cut <- file.path(trimmed.fp, basename(fnFs.filtN))
fnRs.cut <- file.path(trimmed.fp, basename(fnRs.filtN))
# Save the reverse complements of the primers to variables
FWD.RC <- dada2:::rc(FWD)
REV.RC <- dada2:::rc(REV)
## Create the cutadapt flags ##
# Trim FWD and the reverse-complement of REV off of R1 (forward reads)
R1.flags <- paste("-g", FWD, "-a", REV.RC, "--minimum-length 50")
# Trim REV and the reverse-complement of FWD off of R2 (reverse reads)
R2.flags <- paste("-G", REV, "-A", FWD.RC, "--minimum-length 50")
# Run Cutadapt
for (i in seq_along(fnFs)) {
system2(cutadapt, args = c(R1.flags, R2.flags, "-n", 2, # -n 2 required to remove FWD and REV from reads
"-o", fnFs.cut[i], "-p", fnRs.cut[i], # output files
fnFs.filtN[i], fnRs.filtN[i])) # input files
}
# As a sanity check, we will check for primers in the first cutadapt-ed sample:
## should all be zero!
rbind(FWD.ForwardReads = sapply(FWD.orients, primerHits, fn = fnFs.cut[[1]]),
FWD.ReverseReads = sapply(FWD.orients, primerHits, fn = fnRs.cut[[1]]),
REV.ForwardReads = sapply(REV.orients, primerHits, fn = fnFs.cut[[1]]),
REV.ReverseReads = sapply(REV.orients, primerHits, fn = fnRs.cut[[1]]))
## Forward Complement Reverse RevComp
## FWD.ForwardReads 0 0 0 0
## FWD.ReverseReads 0 0 0 0
## REV.ForwardReads 0 0 0 0
## REV.ReverseReads 0 0 0 0
rbind(FWD.ForwardReads = sapply(FWD.orients, primerHits, fn = fnFs.cut[[2]]),
FWD.ReverseReads = sapply(FWD.orients, primerHits, fn = fnRs.cut[[2]]),
REV.ForwardReads = sapply(REV.orients, primerHits, fn = fnFs.cut[[2]]),
REV.ReverseReads = sapply(REV.orients, primerHits, fn = fnRs.cut[[2]]))
## Forward Complement Reverse RevComp
## FWD.ForwardReads 0 0 0 0
## FWD.ReverseReads 0 0 0 0
## REV.ForwardReads 0 0 0 0
## REV.ReverseReads 0 0 0 0
# Put filtered reads into separate sub-directories for big data workflow
dir.create(filter.fp)
subF.fp <- file.path(filter.fp, "preprocessed_F")
subR.fp <- file.path(filter.fp, "preprocessed_R")
dir.create(subF.fp)
dir.create(subR.fp)
# Move R1 and R2 from trimmed to separate forward/reverse sub-directories
fnFs.Q <- file.path(subF.fp, basename(fnFs.filtN))
fnRs.Q <- file.path(subR.fp, basename(fnRs.filtN))
file.rename(from = fnFs.cut, to = fnFs.Q)
## [1] TRUE TRUE TRUE TRUE TRUE TRUE TRUE TRUE TRUE TRUE TRUE TRUE TRUE TRUE TRUE
## [16] TRUE TRUE TRUE TRUE TRUE TRUE TRUE TRUE TRUE TRUE
file.rename(from = fnRs.cut, to = fnRs.Q)
## [1] TRUE TRUE TRUE TRUE TRUE TRUE TRUE TRUE TRUE TRUE TRUE TRUE TRUE TRUE TRUE
## [16] TRUE TRUE TRUE TRUE TRUE TRUE TRUE TRUE TRUE TRUE
# File parsing; create file names and make sure that forward and reverse files match
filtpathF <- file.path(subF.fp, "filtered") # files go into preprocessed_F/filtered/
filtpathR <- file.path(subR.fp, "filtered") # files go into preprocessed_R/filtered/
fastqFs <- sort(list.files(subF.fp, pattern="fastq.gz"))
fastqRs <- sort(list.files(subR.fp, pattern="fastq.gz"))
# Check to make sure your forward and reverse read files are in order.
if(length(fastqFs) != length(fastqRs)) stop("Forward and reverse files do not match.")
Before choosing sequence variants, we want to trim reads where their
quality scores begin to drop (the truncLen and
truncQ values) and remove any low-quality reads that are
left over after we have finished trimming (the maxEE
value).
You will want to change this depending on run chemistry and
quality: For 2x250 bp runs you can try
truncLen=c(240,160) (as per the dada2
tutorial) if your reverse reads drop off in quality. Or you may want
to choose a higher value, for example, truncLen=c(240,200),
if they do not. In truncLen=c(xxx,yyy), xxx
refers to the forward read truncation length, yyy refers to
the reverse read truncation length.
For ITS data: Due to the expected variable read
lengths in ITS data you should run this command without the
trunclen parameter. See here for more information and
appropriate parameters for ITS data: https://benjjneb.github.io/dada2/ITS_workflow.html.
From dada2 tutorial: >If there is only one part of any amplicon bioinformatics workflow on which you spend time considering the parameters, it should be filtering! The parameters … are not set in stone, and should be changed if they don’t work for your data. If too few reads are passing the filter, increase maxEE and/or reduce truncQ. If quality drops sharply at the end of your reads, reduce truncLen. If your reads are high quality and you want to reduce computation time in the sample inference step, reduce maxEE.
It’s important to get a feel for the quality of the data that we are using. To do this, we will plot the quality of some of the samples.
From the dada2 tutorial: >In gray-scale is a heat map of the frequency of each quality score at each base position. The median quality score at each position is shown by the green line, and the quartiles of the quality score distribution by the orange lines. The red line shows the scaled proportion of reads that extend to at least that position (this is more useful for other sequencing technologies, as Illumina reads are typically all the same lenghth, hence the flat red line).
# If the number of samples is 20 or less, plot them all, otherwise, just plot 20 randomly selected samples
if( length(fastqFs) <= 20) {
plotQualityProfile(paste0(subF.fp, "/", fastqFs))
plotQualityProfile(paste0(subR.fp, "/", fastqRs))
} else {
rand_samples <- sample(size = 20, 1:length(fastqFs)) # grab 20 random samples to plot
fwd_qual_plots <- plotQualityProfile(paste0(subF.fp, "/", fastqFs[rand_samples]))
rev_qual_plots <- plotQualityProfile(paste0(subR.fp, "/", fastqRs[rand_samples]))
}
fwd_qual_plots
rev_qual_plots
# Optional: To make these quality plots interactive, call the plots through plotly
ggplotly(fwd_qual_plots)
ggplotly(rev_qual_plots)
# write plots to disk
saveRDS(fwd_qual_plots, paste0(filter.fp, "/fwd_qual_plots.rds"))
saveRDS(rev_qual_plots, paste0(filter.fp, "/rev_qual_plots.rds"))
ggsave(plot = fwd_qual_plots, filename = paste0(filter.fp, "/fwd_qual_plots.png"),
width = 10, height = 10, dpi = "retina")
ggsave(plot = rev_qual_plots, filename = paste0(filter.fp, "/rev_qual_plots.png"),
width = 10, height = 10, dpi = "retina")
| WARNING: THESE PARAMETERS ARE NOT OPTIMAL FOR ALL DATASETS. Make sure you determine the trim and filtering parameters for your data. The following settings are generally appropriate for MiSeq runs that are 2x150 bp. These are the recommended default parameters from the dada2 pipeline. See above for more details. |
filt_out <- filterAndTrim(fwd = file.path(subF.fp, fastqFs),
filt = file.path(filtpathF, fastqFs),
rev = file.path(subR.fp, fastqRs),
filt.rev = file.path(filtpathR, fastqRs),
truncLen = c(150,140),
maxEE = c(2,2),
truncQ = 2,
maxN = 0,
rm.phix = TRUE,
compress = TRUE,
verbose = TRUE,
multithread = TRUE)
# look at how many reads were kept
filt_out
## reads.in reads.out
## R1_ANT7.fastq.gz 40165 38746
## R1_ANT8.fastq.gz 25526 24723
## R1_BA1A5566_10_1D.fastq.gz 50515 48763
## R1_BA1A5566_22_1C.fastq.gz 42238 40623
## R1_BA1A5566_45_1J.fastq.gz 31057 29830
## R1_BB1S.fastq.gz 34353 33063
## R1_BB1W.fastq.gz 39824 38337
## R1_BNS1.fastq.gz 3792 3684
## R1_BNS2.fastq.gz 16915 16362
## R1_C2S.fastq.gz 38469 37037
## R1_C2W.fastq.gz 41979 40359
## R1_CM2A_10_9C.fastq.gz 34309 33206
## R1_CM2A_22_9J.fastq.gz 31079 29844
## R1_COL11.fastq.gz 31560 30423
## R1_COL12.fastq.gz 24413 23608
## R1_COL3.fastq.gz 40397 38933
## R1_COL4.fastq.gz 32665 31406
## R1_DT3S.fastq.gz 36902 35316
## R1_DT3W.fastq.gz 44790 42982
## R1_OM18_BC.fastq.gz 4803 4603
## R1_OM18_BJ.fastq.gz 452 391
## R1_WAB105_22_6J.fastq.gz 44993 43423
## R1_WAB105_45_6D.fastq.gz 37348 36026
## R1_WAB188_10_4D.fastq.gz 31134 29793
## R1_WAB71_45_3D.fastq.gz 43340 41726
# summary of samples in filt_out by percentage
filt_out %>%
data.frame() %>%
mutate(Samples = rownames(.),
percent_kept = 100*(reads.out/reads.in)) %>%
select(Samples, everything()) %>%
summarise(min_remaining = paste0(round(min(percent_kept), 2), "%"),
median_remaining = paste0(round(median(percent_kept), 2), "%"),
mean_remaining = paste0(round(mean(percent_kept), 2), "%"),
max_remaining = paste0(round(max(percent_kept), 2), "%"))
## min_remaining median_remaining mean_remaining max_remaining
## 1 86.5% 96.28% 95.93% 97.15%
# If very few reads made it through, go back and tweak your parameters.
Plot the quality of the filtered fastq files.
# figure out which samples, if any, have been filtered out
if( length(fastqFs) <= 20) {
remaining_samplesF <- fastqFs[
which(fastqFs %in% list.files(filtpathF))] # keep only samples that haven't been filtered out
remaining_samplesR <- fastqRs[
which(fastqRs %in% list.files(filtpathR))] # keep only samples that haven't been filtered out
fwd_qual_plots_filt <- plotQualityProfile(paste0(filtpathF, "/", remaining_samplesF))
rev_qual_plots_filt <- plotQualityProfile(paste0(filtpathR, "/", remaining_samplesR))
} else {
remaining_samplesF <- fastqFs[rand_samples][
which(fastqFs[rand_samples] %in% list.files(filtpathF))] # keep only samples that haven't been filtered out
remaining_samplesR <- fastqRs[rand_samples][
which(fastqRs[rand_samples] %in% list.files(filtpathR))] # keep only samples that haven't been filtered out
fwd_qual_plots_filt <- plotQualityProfile(paste0(filtpathF, "/", remaining_samplesF))
rev_qual_plots_filt <- plotQualityProfile(paste0(filtpathR, "/", remaining_samplesR))
}
fwd_qual_plots_filt
rev_qual_plots_filt
# write plots to disk
saveRDS(fwd_qual_plots_filt, paste0(filter.fp, "/fwd_qual_plots_filt.rds"))
saveRDS(rev_qual_plots_filt, paste0(filter.fp, "/rev_qual_plots_filt.rds"))
ggsave(plot = fwd_qual_plots_filt, filename = paste0(filter.fp, "/fwd_qual_plots_filt.png"),
width = 10, height = 10, dpi = "retina")
ggsave(plot = rev_qual_plots_filt, filename = paste0(filter.fp, "/rev_qual_plots_filt.png"),
width = 10, height = 10, dpi = "retina")
In this part of the pipeline dada2 will learn to distinguish error from biological differences using a subset of our data as a training set. After it understands the error rates, we will reduce the size of the dataset by combining all identical sequence reads into “unique sequences”. Then, using the dereplicated data and error rates, dada2 will infer the amplicon sequence variants (ASVs) in our data. These are essentially OTUs at 100% similarity. Finally, we will merge the corresponding forward and reverse reads to create a list of the fully denoised sequences and create a sequence table from the result.
# File parsing
filtFs <- list.files(filtpathF, pattern="fastq.gz", full.names = TRUE)
filtRs <- list.files(filtpathR, pattern="fastq.gz", full.names = TRUE)
# Sample names in order
sample.names <- substring(basename(filtFs), regexpr("_", basename(filtFs)) + 1) # doesn't drop fastq.gz
sample.names <- gsub(".fastq.gz", "", sample.names)
sample.namesR <- substring(basename(filtRs), regexpr("_", basename(filtRs)) + 1) # doesn't drop fastq.gz
sample.namesR <- gsub(".fastq.gz", "", sample.namesR)
# Double check
if(!identical(sample.names, sample.namesR)) stop("Forward and reverse files do not match.")
names(filtFs) <- sample.names
names(filtRs) <- sample.names
set.seed(100) # set seed to ensure that randomized steps are repeatable
# Learn forward error rates (Notes: randomize default is FALSE)
errF <- learnErrors(filtFs, nbases = 1e8, multithread = TRUE, randomize = TRUE)
## 101455950 total bases in 676373 reads from 22 samples will be used for learning the error rates.
# Learn reverse error rates
set.seed(100) # reset seed to ensure that randomized steps are repeatable
errR <- learnErrors(filtRs, nbases = 1e8, multithread = TRUE, randomize = TRUE)
## 102407340 total bases in 731481 reads from 24 samples will be used for learning the error rates.
We want to make sure that the machine learning algorithm is learning
the error rates properly. In the plots below, the red line represents
what we should expect the learned error rates to look like for each of
the 16 possible base transitions (A->A, A->C, A->G, etc.) and
the black line and grey dots represent what the observed error rates
are. If the black line and the red lines are very far off from each
other, it may be a good idea to increase the nbases
parameter. This allows the machine learning algorithm to train on a
larger portion of your data and may help improve the fit.
errF_plot <- plotErrors(errF, nominalQ = TRUE)
errR_plot <- plotErrors(errR, nominalQ = TRUE)
errF_plot
errR_plot
# write error objects and plots to disk
saveRDS(errF, paste0(filtpathF, "/errF.rds"))
saveRDS(errR, paste0(filtpathR, "/errR.rds"))
saveRDS(errF_plot, paste0(filtpathF, "/errF_plot.rds"))
saveRDS(errR_plot, paste0(filtpathR, "/errR_plot.rds"))
In this part of the pipeline, dada2 will make decisions about
assigning sequences to ASVs (called “sequence inference”). There is a
major parameter option in the core function dada() that changes how
samples are handled during sequence inference. The parameter
pool = can be set to: pool = FALSE (default),
pool = TRUE, or pool = psuedo. For details on
parameter choice, please see below, and further information on this
blogpost http://fiererlab.org/2020/02/17/whats-in-a-number-estimating-microbial-richness-using-dada2/,
and explanation on the dada2 tutorial https://benjjneb.github.io/dada2/pool.html.
Note that some amplicons like ITS have variable read lengths which in
some cases means that reads may not overlap and cannot be merged. In
such cases you may want to opt to just use the forward or reverse reads
rather than merged reads. For more information see https://benjjneb.github.io/dada2/ITS_workflow.html.
Details
pool = FALSE: Sequence information is not shared between
samples. Fast processing time, less sensitivity to rare taxa.
pool = psuedo: Sequence information is shared in a separate
“prior” step. Intermediate processing time, intermediate sensitivity to
rare taxa.
pool = TRUE: Sequence information from all samples is
pooled together. Slow processing time, most sensitivity to rare
taxa.
For simple communities or when you do not need high sensitivity for rare taxa
# make lists to hold the loop output
mergers <- vector("list", length(sample.names))
names(mergers) <- sample.names
ddF <- vector("list", length(sample.names))
names(ddF) <- sample.names
ddR <- vector("list", length(sample.names))
names(ddR) <- sample.names
# For each sample, get a list of merged and denoised sequences
for(sam in sample.names) {
cat("Processing:", sam, "\n")
# Dereplicate forward reads
derepF <- derepFastq(filtFs[[sam]])
# Infer sequences for forward reads
dadaF <- dada(derepF, err = errF, multithread = TRUE)
ddF[[sam]] <- dadaF
# Dereplicate reverse reads
derepR <- derepFastq(filtRs[[sam]])
# Infer sequences for reverse reads
dadaR <- dada(derepR, err = errR, multithread = TRUE)
ddR[[sam]] <- dadaR
# Merge reads together
merger <- mergePairs(ddF[[sam]], derepF, ddR[[sam]], derepR)
mergers[[sam]] <- merger
}
## Processing: ANT7
## Sample 1 - 38746 reads in 16505 unique sequences.
## Sample 1 - 38746 reads in 14810 unique sequences.
## Processing: ANT8
## Sample 1 - 24723 reads in 10738 unique sequences.
## Sample 1 - 24723 reads in 9620 unique sequences.
## Processing: BA1A5566_10_1D
## Sample 1 - 48763 reads in 12161 unique sequences.
## Sample 1 - 48763 reads in 11339 unique sequences.
## Processing: BA1A5566_22_1C
## Sample 1 - 40623 reads in 9985 unique sequences.
## Sample 1 - 40623 reads in 8732 unique sequences.
## Processing: BA1A5566_45_1J
## Sample 1 - 29830 reads in 7601 unique sequences.
## Sample 1 - 29830 reads in 6225 unique sequences.
## Processing: BB1S
## Sample 1 - 33063 reads in 11503 unique sequences.
## Sample 1 - 33063 reads in 9938 unique sequences.
## Processing: BB1W
## Sample 1 - 38337 reads in 10213 unique sequences.
## Sample 1 - 38337 reads in 7858 unique sequences.
## Processing: BNS1
## Sample 1 - 3684 reads in 886 unique sequences.
## Sample 1 - 3684 reads in 809 unique sequences.
## Processing: BNS2
## Sample 1 - 16362 reads in 3931 unique sequences.
## Sample 1 - 16362 reads in 3576 unique sequences.
## Processing: C2S
## Sample 1 - 37037 reads in 14537 unique sequences.
## Sample 1 - 37037 reads in 12349 unique sequences.
## Processing: C2W
## Sample 1 - 40359 reads in 9705 unique sequences.
## Sample 1 - 40359 reads in 6851 unique sequences.
## Processing: CM2A_10_9C
## Sample 1 - 33206 reads in 5265 unique sequences.
## Sample 1 - 33206 reads in 4317 unique sequences.
## Processing: CM2A_22_9J
## Sample 1 - 29844 reads in 5688 unique sequences.
## Sample 1 - 29844 reads in 4663 unique sequences.
## Processing: COL11
## Sample 1 - 30423 reads in 15072 unique sequences.
## Sample 1 - 30423 reads in 13813 unique sequences.
## Processing: COL12
## Sample 1 - 23608 reads in 11851 unique sequences.
## Sample 1 - 23608 reads in 10657 unique sequences.
## Processing: COL3
## Sample 1 - 38933 reads in 19379 unique sequences.
## Sample 1 - 38933 reads in 17624 unique sequences.
## Processing: COL4
## Sample 1 - 31406 reads in 15661 unique sequences.
## Sample 1 - 31406 reads in 14126 unique sequences.
## Processing: DT3S
## Sample 1 - 35316 reads in 12977 unique sequences.
## Sample 1 - 35316 reads in 11359 unique sequences.
## Processing: DT3W
## Sample 1 - 42982 reads in 11632 unique sequences.
## Sample 1 - 42982 reads in 8518 unique sequences.
## Processing: OM18_BC
## Sample 1 - 4603 reads in 1285 unique sequences.
## Sample 1 - 4603 reads in 1101 unique sequences.
## Processing: OM18_BJ
## Sample 1 - 391 reads in 130 unique sequences.
## Sample 1 - 391 reads in 112 unique sequences.
## Processing: WAB105_22_6J
## Sample 1 - 43423 reads in 9283 unique sequences.
## Sample 1 - 43423 reads in 8167 unique sequences.
## Processing: WAB105_45_6D
## Sample 1 - 36026 reads in 7663 unique sequences.
## Sample 1 - 36026 reads in 7031 unique sequences.
## Processing: WAB188_10_4D
## Sample 1 - 29793 reads in 6088 unique sequences.
## Sample 1 - 29793 reads in 4871 unique sequences.
## Processing: WAB71_45_3D
## Sample 1 - 41726 reads in 10190 unique sequences.
## Sample 1 - 41726 reads in 9586 unique sequences.
rm(derepF); rm(derepR)
For complex communities when you want to preserve rare taxa. Note:
This adds substantially more computational time!! Learn more about
pooling here: https://benjjneb.github.io/dada2/pool.html.
The DADA2 author Benjamin Callahan states there that: “The large
majority of ASVs, and the vast majority of reads (>99%) are commonly
assigned between these methods. Either method provides an accurate
reconstruction of your sampled communities.” alternative: swap
pool = TRUE with pool = "pseudo"
# same steps, but not in loop because samples are now pooled
# Dereplicate forward reads
derepF.p <- derepFastq(filtFs)
names(derepF.p) <- sample.names
# Infer sequences for forward reads
dadaF.p <- dada(derepF.p, err = errF, multithread = TRUE, pool = TRUE)
names(dadaF.p) <- sample.names
# Dereplicate reverse reads
derepR.p <- derepFastq(filtRs)
names(derepR.p) <- sample.names
# Infer sequences for reverse reads
dadaR.p <- dada(derepR.p, err = errR, multithread = TRUE, pool = TRUE)
names(dadaR.p) <- sample.names
# Merge reads together
mergers <- mergePairs(dadaF.p, derepF.p, dadaR.p, derepR.p)
seqtab <- makeSequenceTable(mergers)
# Save table as an r data object file
dir.create(table.fp)
saveRDS(seqtab, paste0(table.fp, "/seqtab.rds"))
If you have multiple sequencing runs, if you have processed them each to this point, you can now load all of your different seqtab.rds files in here and merge them. Then you can remove chimeras and assign taxonomy just on the one merged table.
# seqtab1 <- readRDS(paste0(table.fp, "/seqtab.rds"))
# seqtab2 <- readRDS("path/to/other/seqtab.rds")
# seqtab <- mergeSequenceTables(seqtab1, seqtab2)
Although dada2 has searched for indel errors and substitutions, there may still be chimeric sequences in our dataset (sequences that are derived from forward and reverse sequences from two different organisms becoming fused together during PCR and/or sequencing). To identify chimeras, we will search for rare sequence variants that can be reconstructed by combining left-hand and right-hand segments from two more abundant “parent” sequences. After removing chimeras, we will use a taxonomy database to train a naive Bayesian classifier-algorithm to assign names to our sequence variants.
For the tutorial 16S, we will assign taxonomy with SILVA db v138.1, but you might want to use other databases for your data. This one includes species but be wary of species level assignments. It’s always a good idea to BLAST your top ASVs of interest to confirm the taxonomy. Other options for 16S include Greengenes, GTDB, and RDP. Below are paths to some of the databases we use often. If you want to use SILVA for 18S instead of PR2, make sure you use the one that is suitable for 18S, which is different than the 16S one and is from release 132. Databases are periodically updated so make sure you check for new releases and use the latest versions. (If you are on your own computer you can download the database you need from this link https://benjjneb.github.io/dada2/training.html:)
16S bacteria and archaea (SILVA db): /db_files/dada2/silva_nr99_v138.1_train_set.fa
ITS fungi (UNITE db): /db_files/dada2/sh_general_release_dynamic_25.07.2023.fasta
18S protists (PR2 db): /db_files/dada2/pr2_version_5.0.0_SSU_dada2.fasta.gz
# Read in RDS
st.all <- readRDS(paste0(table.fp, "/seqtab.rds"))
# Remove chimeras
seqtab.nochim <- removeBimeraDenovo(st.all,
method = "consensus",
multithread = TRUE)
# Print percentage of our sequences that were not chimeric.
100*sum(seqtab.nochim)/sum(seqtab)
## [1] 98.34444
# Print starting number of ASVs, number of chimeras, and non-chimeric ASVs
ncol(st.all) # starting number of ASVs
## [1] 6283
ncol(st.all) - ncol(seqtab.nochim) # number of chimeras. there are removed.
## [1] 443
ncol(seqtab.nochim) # number of non-chimeric ASVs
## [1] 5840
# Assign taxonomy
# Note: assignTaxonomy implements the RDP Naive Bayesian Classifier algorithm described in Wang et al. Applied and Environmental Microbiology 2007, with kmer size 8 and 100 bootstrap replicates.
tax <- assignTaxonomy(seqs = seqtab.nochim,
refFasta = "/db_files/dada2/silva_nr99_v138.1_train_set.fa",
minBoot = 50,
tryRC = TRUE,
outputBootstraps = FALSE,
taxLevels = c("Kingdom", "Phylum", "Class", "Order", "Family", "Genus"),
multithread = TRUE,
verbose = FALSE)
# If you want to add species level, you must use this separate function that uses exact matching
tax <- addSpecies(taxtab = tax,
refFasta = "/db_files/dada2/silva_species_assignment_v138.1.fa.gz",
allowMultiple = FALSE,
tryRC = TRUE,
n = 1e5,
verbose = FALSE)
# Write results to disk
saveRDS(seqtab.nochim, paste0(table.fp, "/seqtab_final.rds"))
saveRDS(tax, paste0(table.fp, "/tax_final.rds"))
For convenience, we will now rename our ASVs with numbers, output our results as a traditional taxa table, and create a matrix with the representative sequences for each ASV. Having the actual sequences for each ASV is important if you want to build a phylogenetic tree or do additional taxonomic investigation.
# Flip table
seqtab.t <- as.data.frame(t(seqtab.nochim))
# Pull out ASV repset
rep_set_ASVs <- as.data.frame(rownames(seqtab.t))
rep_set_ASVs <- mutate(rep_set_ASVs, ASV_ID = 1:n())
rep_set_ASVs$ASV_ID <- sub("^", "ASV_", rep_set_ASVs$ASV_ID)
rep_set_ASVs$ASV <- rep_set_ASVs$`rownames(seqtab.t)`
rep_set_ASVs$`rownames(seqtab.t)` <- NULL
# Add ASV numbers to table
rownames(seqtab.t) <- rep_set_ASVs$ASV_ID
# Add ASV numbers to taxonomy
taxonomy <- as.data.frame(tax)
taxonomy$ASV <- as.factor(rownames(taxonomy))
taxonomy <- merge(rep_set_ASVs, taxonomy, by = "ASV")
rownames(taxonomy) <- taxonomy$ASV_ID
# Note: If you used a database that only goes to genus level, delete the "Species" level here.
# Note: In mctoolsr, these will correspond to taxonomy1-8 (or 1-7 for genus level)
taxonomy_for_mctoolsr <- unite(taxonomy,
"taxonomy",
c("Kingdom", "Phylum", "Class", "Order",
"Family", "Genus", "Species", "ASV_ID"),
sep = ";")
# Write repset to fasta file
# create a function that writes fasta sequences
writeRepSetFasta<-function(data, filename){
fastaLines = c()
for (rowNum in 1:nrow(data)){
fastaLines = c(fastaLines, as.character(paste(">", data[rowNum,"name"], sep = "")))
fastaLines = c(fastaLines,as.character(data[rowNum,"seq"]))
}
fileConn<-file(filename)
writeLines(fastaLines, fileConn)
close(fileConn)
}
# Arrange the taxonomy dataframe for the writeRepSetFasta function
# Note: Remove Species according to your database.
taxonomy_for_fasta <- taxonomy %>%
unite("TaxString",
c("Kingdom", "Phylum", "Class", "Order",
"Family", "Genus", "Species", "ASV_ID"),
sep = ";",
remove = FALSE) %>%
unite("name",
c("ASV_ID", "TaxString"),
sep = " ",
remove = TRUE) %>%
select(ASV, name) %>%
rename(seq = ASV)
# write fasta file
writeRepSetFasta(taxonomy_for_fasta, paste0(table.fp, "/repset.fasta"))
# Merge taxonomy and table
seqtab_wTax <- merge(seqtab.t, taxonomy_for_mctoolsr, by = 0)
seqtab_wTax$ASV <- NULL
# Set name of table in mctoolsr format and save
out_fp <- paste0(table.fp, "/seqtab_wTax_mctoolsr.txt")
names(seqtab_wTax)[1] = "#ASV_ID"
write("#Exported for mctoolsr", out_fp)
suppressWarnings(write.table(seqtab_wTax, out_fp, sep = "\t", row.names = FALSE, append = TRUE))
# Also export files as .txt
write.table(seqtab.t, file = paste0(table.fp, "/seqtab_final.txt"),
sep = "\t", row.names = TRUE, col.names = NA)
write.table(tax, file = paste0(table.fp, "/tax_final.txt"),
sep = "\t", row.names = TRUE, col.names = NA)
# Optional: Output for phyloseq, if you use phyloseq instead of mctoolsr
# library(BiocManager)
# BiocManager::install("phyloseq")
# library(phyloseq)
# Use seqtab.nochim for the otu_table
# Use the tax object from assignTaxonomy() for the tax_table
# Load in your sample metadata and call it samdf. Sample IDs much match the row names of seqtab.nochim
# ps <- phyloseq(otu_table(seqtab.nochim, taxa_are_rows = FALSE),
# sample_data(samdf),
# tax_table(tax))
Here we track the reads throughout the pipeline to see if any step is resulting in a greater-than-expected loss of reads. If a step is showing a greater than expected loss of reads, it is a good idea to go back to that step and troubleshoot why reads are dropping out. The dada2 tutorial has more details about what can be changed at each step.
getN <- function(x) sum(getUniques(x)) # function to grab sequence counts from output objects
# tracking reads by counts
filt_out_track <- filt_out %>%
data.frame() %>%
mutate(Sample = gsub("(R1\\_)(.{1,})(\\.fastq\\.gz)","\\2",rownames(.))) %>%
rename(input = reads.in, filtered = reads.out)
rownames(filt_out_track) <- filt_out_track$Sample
# If you did not pool samples, use this
ddF_track <- data.frame(denoisedF = sapply(ddF[sample.names], getN)) %>%
mutate(Sample = row.names(.))
ddR_track <- data.frame(denoisedR = sapply(ddR[sample.names], getN)) %>%
mutate(Sample = row.names(.))
# If you used samples = pooled, use this
# ddF_track <- data.frame(denoisedF = sapply(derepF.p[sample.names], getN)) %>% mutate(Sample = row.names(.))
# ddR_track <- data.frame(denoisedR = sapply(derepR.p[sample.names], getN)) %>% mutate(Sample = row.names(.))
merge_track <- data.frame(merged = sapply(mergers, getN)) %>%
mutate(Sample = row.names(.))
chim_track <- data.frame(nonchim = rowSums(seqtab.nochim)) %>%
mutate(Sample = row.names(.))
track <- left_join(filt_out_track, ddF_track, by = "Sample") %>%
left_join(ddR_track, by = "Sample") %>%
left_join(merge_track, by = "Sample") %>%
left_join(chim_track, by = "Sample") %>%
replace(., is.na(.), 0) %>%
select(Sample, everything())
row.names(track) <- track$Sample
track
## Sample input filtered denoisedF denoisedR merged nonchim
## ANT7 ANT7 40165 38746 36988 37217 30862 30726
## ANT8 ANT8 25526 24723 23307 23554 18873 18762
## BA1A5566_10_1D BA1A5566_10_1D 50515 48763 48233 48059 46759 45399
## BA1A5566_22_1C BA1A5566_22_1C 42238 40623 40162 40225 38940 37117
## BA1A5566_45_1J BA1A5566_45_1J 31057 29830 29398 29519 28618 25794
## BB1S BB1S 34353 33063 31892 32190 28326 28191
## BB1W BB1W 39824 38337 38014 38028 33867 33359
## BNS1 BNS1 3792 3684 3668 3667 3655 3655
## BNS2 BNS2 16915 16362 16308 16295 16170 16170
## C2S C2S 38469 37037 35623 35976 31203 31087
## C2W C2W 41979 40359 40093 40185 39706 39477
## CM2A_10_9C CM2A_10_9C 34309 33206 33116 33124 32979 32751
## CM2A_22_9J CM2A_22_9J 31079 29844 29785 29786 29418 29418
## COL11 COL11 31560 30423 27972 28588 20030 19875
## COL12 COL12 24413 23608 21511 22048 15347 15055
## COL3 COL3 40397 38933 35689 36566 25853 25666
## COL4 COL4 32665 31406 28888 29523 21331 21070
## DT3S DT3S 36902 35316 34167 34553 30666 30663
## DT3W DT3W 44790 42982 42575 42697 41470 40453
## OM18_BC OM18_BC 4803 4603 4564 4575 4526 4526
## OM18_BJ OM18_BJ 452 391 377 382 376 376
## WAB105_22_6J WAB105_22_6J 44993 43423 42958 43102 41792 41121
## WAB105_45_6D WAB105_45_6D 37348 36026 35477 35596 34455 33207
## WAB188_10_4D WAB188_10_4D 31134 29793 29587 29656 29107 29101
## WAB71_45_3D WAB71_45_3D 43340 41726 41478 41484 40637 40607
# tracking reads by percentage
track_pct <- track %>%
data.frame() %>%
mutate(Sample = rownames(.),
filtered_pct = ifelse(filtered == 0, 0, 100 * (filtered/input)),
denoisedF_pct = ifelse(denoisedF == 0, 0, 100 * (denoisedF/filtered)),
denoisedR_pct = ifelse(denoisedR == 0, 0, 100 * (denoisedR/filtered)),
merged_pct = ifelse(merged == 0, 0, 100 * merged/((denoisedF + denoisedR)/2)),
nonchim_pct = ifelse(nonchim == 0, 0, 100 * (nonchim/merged)),
total_pct = ifelse(nonchim == 0, 0, 100 * nonchim/input)) %>%
select(Sample, ends_with("_pct"))
# summary stats of tracked reads averaged across samples
track_pct_avg <- track_pct %>% summarize_at(vars(ends_with("_pct")),
list(avg = mean))
track_pct_med <- track_pct %>% summarize_at(vars(ends_with("_pct")),
list(med = stats::median))
track_pct_avg
## filtered_pct_avg denoisedF_pct_avg denoisedR_pct_avg merged_pct_avg
## 1 95.93076 97.20694 97.85535 91.05881
## nonchim_pct_avg total_pct_avg
## 1 98.61956 84.18239
track_pct_med
## filtered_pct_med denoisedF_pct_med denoisedR_pct_med merged_pct_med
## 1 96.27596 98.86517 98.95743 97.11918
## nonchim_pct_med total_pct_med
## 1 99.41186 87.87585
# Plotting each sample's reads through the pipeline
track_plot <- track %>%
data.frame() %>%
mutate(Sample = rownames(.)) %>%
gather(key = "Step", value = "Reads", -Sample) %>%
mutate(Step = factor(Step,
levels = c("input", "filtered", "denoisedF", "denoisedR", "merged", "nonchim"))) %>%
ggplot(aes(x = Step, y = Reads)) +
geom_line(aes(group = Sample), alpha = 0.2) +
geom_point(alpha = 0.5, position = position_jitter(width = 0)) +
stat_summary(fun = median, geom = "line", group = 1, color = "steelblue", size = 1, alpha = 0.5) +
stat_summary(fun = median, geom = "point", group = 1, color = "steelblue", size = 2, alpha = 0.5) +
stat_summary(fun.data = median_hilow, fun.args = list(conf.int = 0.5),
geom = "ribbon", group = 1, fill = "steelblue", alpha = 0.2) +
geom_label(data = t(track_pct_avg[1:5]) %>% data.frame() %>%
rename(Percent = 1) %>%
mutate(Step = c("filtered", "denoisedF", "denoisedR", "merged", "nonchim"),
Percent = paste(round(Percent, 2), "%")),
aes(label = Percent), y = 1.1 * max(track[,2])) +
geom_label(data = track_pct_avg[6] %>% data.frame() %>%
rename(total = 1),
aes(label = paste("Total\nRemaining:\n", round(track_pct_avg[1,6], 2), "%")),
y = mean(track[,6]), x = 6.5) +
expand_limits(y = 1.1 * max(track[,2]), x = 7) +
theme_classic()
track_plot
# Write results to disk
saveRDS(track, paste0(project.fp, "/tracking_reads.rds"))
saveRDS(track_pct, paste0(project.fp, "/tracking_reads_percentage.rds"))
saveRDS(track_plot, paste0(project.fp, "/tracking_reads_summary_plot.rds"))
You can now transfer over the output files onto your local computer. The table and taxonomy can be read into R with ‘mctoolsr’ package or another R package of your choosing.
After following this pipeline, you will need to think about the following in downstream applications:
For more information on these steps, see https://github.com/cliffbueno/Alpha-Beta-Tutorial